Technical documents

Twist Bioscience attests that the company adheres to all requirements in the U.S. Office of Science and Technology Policy (OSTP) Framework for Nucleic Acid Synthesis Screening.

Download the attestation here .

Twist Bioscience ships its DNA products dried down or resuspended in 2 mL microcentrifuge tubes, 96-well plates, or 384-well plates. Dried DNA is shipped at ambient temperature and resuspended DNA is shipped frozen.

Double-stranded DNA and single-stranded oligonucleotides are stable under most standard laboratory storage conditions. However, it is important to consider the following best practices to maintain the high quality of the DNA synthesized by Twist Bioscience.

Twist recommends storing dried DNA for the following durations based on storage condition:

• Room temperature for 3 months.
• 4° C for 12 months.
• -20° C for 24 months.
• -80° C for long term storage.

Resuspension Guidelines

• For resuspension, briefly centrifuge the tube or plate before opening and resuspend in nuclease free Tris-EDTA (TE) buffer, pH 8.0 or 10 mM Tris-HCl, pH 8.0 to the desired concentration.
• A concentration of at least 10 ng/μL is recommended for the stock dilution, but the optimal concentration will need to be determined based on your desired application.
• Prepare aliquots of the stock dilution and separate working aliquots to limit chances of contamination and to reduce the number of freeze/thaw cycles.
• Use working aliquots as soon as possible after preparation and minimize exposure to high temperatures.

Resuspended DNA

Resuspension is available for some products. Your DNA may arrive in one of the following buffers. We recommend briefly centrifuging the tube or plate before opening.

• Elution buffer: 2 mM Tris-Cl, pH 8.5
• TE buffer: 10 mM Tris-Cl pH 8.0, 1 mM EDTA
• TE Buffer low EDTA: 10 mM Tris-Cl pH 8.0, 0.1 mM EDTA
• Water

We do not recommend long-term storage in water.

Twist recommends storing resuspended DNA for the following durations based on storage condition:

• Room temperature for 3 months.
• 4° C for 12 months.
• -20° C for 24 months.
• -80° C for long term storage.

All of our Clonal Gene synthesis products are NGS sequence verified.

Gene Fragments are not NGS verified. With a low error rate for gene synthesis, we estimate that you will need to sequence approximately 3, 4, or 6 colonies for Gene Fragments of 600, 1200, or 1800 bps respectively to obtain a sequence perfect clone with 99% confidence.

Gene products are typically delivered as a dried-down product unless otherwise specified.

Clonal Genes are delivered cloned into one Twist's catalog vectors or your own custom vector. Gene Fragments are delivered as linear, double stranded sequences with or without flanking adapters.

We deliver the gene sequences in 96/384-well plates. For small orders of fewer than 10 genes, the genes can be delivered in tubes at no additional cost. For orders with 10 or more genes, tube order requests are an additional $50 per order.

Twist DNA products are dried down and shipped in either 96/384-well plates or 2 ml microcentrifuge tubes. Although double-stranded DNAs are stable under most standard storage conditions, we recommend the following to maintain high quality DNA:

• Upon receipt, briefly centrifuge tube or plate and resuspend the DNA in nuclease free Tris-EDTA (TE) buffer, pH 8.0 or 10 mM Tris-HCl, pH 8.0 to the desired concentration.
• We do not recommend resuspension in water.
• A concentration of at least 10 ng/ul is recommended for a stock solution, but optimal concentration will need to be determined based on your desired application.
• Prepare aliquots of the stock and separate working aliquots to limit the chances of contamination and reduce the number of freeze/thaw cycles.
• For long term storage, freeze DNA at -20° C for up to one year, or at -80° C for even longer storage.

Resuspension guideline can be found here .

Yes, there is an additional charge of $10 per gene.

Twist can clone gene synthesis products of up to 5,000 bp into any of our catalog vectors. We also offer cloning into your own custom vector.

The only Twist-provided vector that contains a Kozak sequence is pTwist ENTR Kozak. All remaining Cloning, Expression, and antibody backbone vectors offered by Twist Bioscience DO NOT contain Kozak or signal peptide (leader) sequences. Twist recommends including a Kozak (GCCGCCACC or variant) along with a signal sequence when planning to express proteins in Mammalian expression systems.

No - at this time, Twist does not have vectors for expression in plants; however, we can onboard a custom vector as long as it meets our requirements.

You can find the pricing table for Clonal Gene products in your account by clicking here.

If you need to contact your Account Manager regarding pricing, their contact information is available in eCommerce under Account.

You can find the pricing table for Gene Fragment products in your account by clicking here.

If you need to contact your Account Manager regarding pricing, their contact information is available in eCommerce under Account.

You can use the following methods to clone gene fragments with adapters:

• Restriction digestion/Ligation - place restriction sites inside of the Twist adapters for easy cloning.
• Type IIS or Golden Gate - place restriction sites inside of the Twist adapters for easy cloning.
• TOPO cloning (blunt-end) - the adapter sequences will be cloned in as well.
• Gateway cloning - add attB sites to the ends of your sequence.

For more information, click here.

For Adapter-On Gene Fragments, universal adapters are synthesized onto the ends of each fragment. The adapters are 21-22 nucleotides in length. Fragments with these adapters are compatible with a number of assembly methods, namely Restriction Digestion/Ligation, Gateway, Golden Gate, and TOPO cloning.

The addition of restriction sites inside of the adapters can be used to remove adapters. TOPO cloning will work but will leave the adapters on.

ADAPTER SEQUENCES

For orders received before August 9, 2021, the adapter sequences are as follows:

5' Adapter: GAAGTGCCATTCCGCCTGACCT
3' Adapter: AGGCTAGGTGGAGGCTCAGTG
5’ – GAAGTGCCATTCCGCCTGACCT – insert – AGGCTAGGTGGAGGCTCAGTG – 3'

For orders received after August 9, 2021 to November 1, 2021, the adapter sequences are as follows:

5' Adapter: CCCCGTCACCTTTGGCTTATCAGT
3' Adapter: AGTGACATCTGGACGCTAAGACCG
5’ - CCCCGTCACCTTTGGCTTATCAGT – insert – AGTGACATCTGGACGCTAAGACCG - 3'

For orders received after November 2, 2021, the adapter sequences are as follows:

5' Adapter: CAATCCGCCCTCACTACAACCG
3' Adapter: CTACTCTGGCGTCGATGAGGGA
5’ - CAATCCGCCCTCACTACAACCG – insert – CTACTCTGGCGTCGATGAGGGA - 3'

*Adapters are short sequences added to each end of the insert as part of our synthesis process. Gene fragments without these adapters are also available during the checkout process.

If you have any questions about your order, please contact us at customersupport@twistbioscience.com.

Yes, gene fragments go through a bead-based clean up; however, short fragments can carry over in small quantities.

For orders received before August 9, 2021, the adapter sequences are as follows:

5' Adapter: GAAGTGCCATTCCGCCTGACCT
3' Adapter: AGGCTAGGTGGAGGCTCAGTG
5’ – GAAGTGCCATTCCGCCTGACCT – insert – AGGCTAGGTGGAGGCTCAGTG – 3'

For orders received after August 9, 2021 to November 1, 2021, the adapter sequences are as follows:

5' Adapter: CCCCGTCACCTTTGGCTTATCAGT
3' Adapter: AGTGACATCTGGACGCTAAGACCG
5’ - CCCCGTCACCTTTGGCTTATCAGT – insert – AGTGACATCTGGACGCTAAGACCG - 3'

For orders received after November 2, 2021, the adapter sequences are as follows:

5' Adapter: CAATCCGCCCTCACTACAACCG
3' Adapter: CTACTCTGGCGTCGATGAGGGA
5’ - CAATCCGCCCTCACTACAACCG – insert – CTACTCTGGCGTCGATGAGGGA - 3'

*Adapters are short sequences added to each end of the insert as part of our synthesis process. Gene fragments without these adapters are also available during the checkout process.

If you have any questions about your order, please contact us at customersupport@twistbioscience.com.

Here is a list of organisms that are supported for codon optimization on our website:

• Arabidopsis thaliana
• Aspergillus niger
• Aspergillus oryzae
• Bacillus subtilis
• Brassica napus
• Caenorhabditis elegans
• Cricetulus griseus (CHO)
• Drosophila melanogaster
• Escherichia coli
• Glycine max
• Homo sapiens
• Hypocrea jecorina
• Medicago sativa
• Mus musculus
• Nicotiana tabacum
• Petunia x hybrida
• Pichia pastoris
• Pisum sativum
• Rattus norvegicus
• Saccharomyces cerevisiae
• Solanum tuberosum
• Spodoptera frugiperda
• Streptomyces coelicolor A3(2)
• Sus scrofa
• Toxoplasma gondii
• Xenopus laevis
• Yarrowia lipolytica
• Zea mays

If you do not see your specific organism, contact customersupport@twistbioscience.com.

Currently, we are unable to synthesize genes that score as Impossible. There are several factors that cause our algorithm to score a gene Impossible and the specific parameters are unique to the gene sequence. Our algorithm is proprietary and was developed using machine learning. In addition to machine learning, our algorithm does take into consideration the following factors:

• %GC between 25-65%
• Max homopolymer length < 10
• Low homology

A unique combination of the above is a reflection of the specific gene sequence score of Impossible.

To maintain wild-type protein expression:

• We avoid using rare codons (those with a codon frequency of <8%).
• We ensure sequences do not have strong hairpins (ΔG < -8) in the first 48 base pairs of resulting sequences.
• We check both strands to ensure they don’t contain the enzyme cut sites you asked us to avoid.
• We avoid introducing promoter sequences internal to expression sequences by avoiding the creation of strong sigma70 binding sites.
• We avoid sequences that create strong ribosome binding sites (GGAGG and TAAGGAG).
• We avoid sequences that create terminator sequences (TTTTT or AAAAA).

To improve the likelihood of successful manufacture:

• We won’t introduce any repeat longer than 20 base pairs.
• We avoid homopolymer runs of 10 or more bases.
• We avoid fitted sequences that create global GC% of less than 25% or more than 65% and local GC windows (50 bp) of less than 35% or more than 65%.

Please note that codon optimization is useful for improving chances of a successful synthesis, not protein expression.

Synthesis issues are driven mainly by repetitive structures, extreme GC content, and homopolymers. We use a machine learning method to determine the chance of success. Therefore, most of the time, there is no single reason for the rejection of a sequence. Rather, complexity or rejection stem from a combination of features that push a sequence into a given bucket of complexity. The only hard rules are the following:

• Avoid homopolymers >= 14bp
• Do not include CcdB (Type II Toxin-antitoxin system)

Should you encounter an issue, we recommend removing or minimizing repeats, regions of extreme GC content, and homopolymers. We will highlight regions of concern if your sequence is complex, unbuildable, or contains sequences which conflict with our internal processes.

After submitting your gene sequences on our website, they will be automatically scored for feasibility of assembly:

Standard: No errors have been found. Gene sequence found to be of "standard" overall complexity (e.g. length, GC content, homology, etc).

Complex: No errors have been found. Some sequence complexities (e.g. length, GC content, homology, etc) exist but we do not expect any problems synthesizing your gene. Rarely, sequences may experience increased turnaround time or risk of manufacturing failure.

Error: Gene sequence contains errors. Please click on the sequence to get more details on how to resolve them.

Not Accepted: The sequence contains elements that make it impossible for us to synthesize. Please see the detailed explanations provided with the error message or refer to the “Design Guidelines”.

About Scoring System

Our scoring system adopts a machine learning model which analyzes and combines multiple sequence parameters ( i.e. overall GC percent, maximum homopolymer length, maximum repeat length, sequence length, repeat density, etc.). This model was trained using our historical manufacturing data, and it provides a more precise estimation of production success for genes and antibody products

About ISSUE messages

Warnings: Are associated with the risk of failure, predicted by the machine learning model. A higher number of warnings is more likely to result in a “Not Accepted” score.

Errors: Are not associated with gene complexity, and they can be fixed by correcting the gene design

Our website will accept amino acid sequences and convert them to a DNA sequence for synthesis. At the upload sequences page, select the Amino Acid Sequence option.

Make sure your input only contains Amino Acid one-letter characters. We support only the standard 20 one-letter code characters.

A "*" at the end of your amino acid sequences marks a stop codon (we do not add stop codons automatically).

Based on the Codon Usage Table you choose, the most frequently used codons will be selected.

If you do not see your specific organism, contact customersupport@twistbioscience.com for help.

Note for Clonal Genes: Not all Twist expression vectors contain standard expression machinery upstream of the insertion point. We recommend double-checking the sequence of your final plasmid construct by clicking "Download Sequences" after selecting your desired vector.

Customers have the option of ordering oligo pools, gene fragments, and clonal genes.

Oligonucleotides (linear single-stranded DNAs) in an oligo pool can range in size from 20 bp to 300 bp.

Gene fragments are linear double-stranded DNAs that can range in size between 300 bp and 5,000 bp in length.

Clonal genes are double-stranded DNAs that have been cloned into one of Twist’s vectors or a customer-provided custom vector. Clonal genes can range in size between 300 bp and 5,000 bp in length.